| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.235606 |
| Chromosome: | chromosome 3 |
| Location: | 140370 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144084 | RBL7 | Rhomboid-like protease; (1 of 11) 3.4.21.105 - Rhomboid protease | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGAGTGCAAGCGCGGGAGCAGAGGCGGT |
| Internal bar code: | GTCGGTTTTGACGCACGGCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 477 |
| LEAP-Seq percent confirming: | 91.9754 |
| LEAP-Seq n confirming: | 6281 |
| LEAP-Seq n nonconfirming: | 548 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGTGACACGAGGTATTGA |
| Suggested primer 2: | TGCTGCTCACAGCCTTCTAC |