| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.235631 |
| Chromosome: | chromosome 8 |
| Location: | 141952 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358539 | (1 of 2) PTHR13009:SF8 - AHSA1 PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGTCAAACCTACAATCGCGATGATGAAC |
| Internal bar code: | GAGCAGGGGAAAGCGGATGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 231 |
| LEAP-Seq percent confirming: | 99.5212 |
| LEAP-Seq n confirming: | 1455 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCTCCTCCTGACTGGTA |
| Suggested primer 2: | ACCCCAGTATCCTACCCCAC |