Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.235712 |
Chromosome: | chromosome 17 |
Location: | 5146083 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g735350 | FAP164 | (1 of 1) PTHR24198//PTHR24198:SF57 - ANKYRIN REPEAT AND PROTEIN KINASE DOMAIN-CONTAINING PROTEIN // SUBFAMILY NOT NAMED; Ankyrin Repeat Flagellar Associated Protein 164 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAACCCTGAACCTCCCCCTCCCTTCCC |
Internal bar code: | GCGGGTGGAGTGGGTCACCTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 418 |
LEAP-Seq percent confirming: | 99.124 |
LEAP-Seq n confirming: | 2942 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCTAACACAGTCCCAAGA |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |