| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.235741 |
| Chromosome: | chromosome 7 |
| Location: | 5927917 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354200 | GAP2 | Glyceraldehyde 3-phosphate dehydrogenase, GAPC, cytosolic; (1 of 2) 1.2.1.12 - Glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) / Triosephosphate dehydrogenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGTACGTGAAATGTACGTGCTCCATTC |
| Internal bar code: | TTTTGGCTCACTTATTGAGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 901 |
| LEAP-Seq percent confirming: | 98.2405 |
| LEAP-Seq n confirming: | 10162 |
| LEAP-Seq n nonconfirming: | 182 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGCATACGGGGACTGTTC |
| Suggested primer 2: | CCCAGCACCACATACACAAC |