Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.235770 |
Chromosome: | chromosome 16 |
Location: | 4175954 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g668800 | MTA4 | Predicted protein; (1 of 2) PTHR24032:SF25 - SPORE COAT PROTEIN SP85 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAATGCGCCATGCTTCCCGCTCCCTGT |
Internal bar code: | CTCATGCTAACGCTCGCATCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 546 |
LEAP-Seq percent confirming: | 88.535 |
LEAP-Seq n confirming: | 139 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTGTGTGGAGGACCAGTG |
Suggested primer 2: | ATCCACTTGAAACTCCCACG |