Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.235780 |
Chromosome: | chromosome 4 |
Location: | 384112 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217915 | NAR1C | Formate/nitrite transporter; (1 of 1) IPR000292//IPR023271 - Formate/nitrite transporter // Aquaporin-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACACACACGCCCACACACAGGTCACGC |
Internal bar code: | GCGGCGGTCTGCCGATCAATTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 462 |
LEAP-Seq percent confirming: | 93.4831 |
LEAP-Seq n confirming: | 416 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAGGTAGGGGAGGTAAAG |
Suggested primer 2: | CGACCCCAGAATGAAGTTGT |