| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.235798 |
| Chromosome: | chromosome 10 |
| Location: | 2319642 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434800 | (1 of 1) PF00515//PF02151//PF13414 - Tetratricopeptide repeat (TPR_1) // UvrB/uvrC motif (UVR) // TPR repeat (TPR_11) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGGTGTTCTGCCGCTTGGGACGCACAAG |
| Internal bar code: | CGGTCGATGGAGCAGTCAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 671 |
| LEAP-Seq percent confirming: | 96.957 |
| LEAP-Seq n confirming: | 5321 |
| LEAP-Seq n nonconfirming: | 167 |
| LEAP-Seq n unique pos: | 99 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACGGTCAACTACCTCAT |
| Suggested primer 2: | GTAGTGACCGGGACAAGGAA |