Insertion junction: LMJ.RY0402.235798_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.235798
Chromosome:chromosome_10
Location:2319644
Confidence (%):95
Locus systematic id Locus common name Defline Orientation Feature
Cre10.g434800 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCAGCCTGCCACCAGCTCGATGCAGTCCTG
Internal bar code:TAATGTGGTAAAACTTAATCAG

Confirmation - LEAP-Seq

LEAP-Seq distance:1009
LEAP-Seq percent confirming:99.398
LEAP-Seq n confirming:10403
LEAP-Seq n nonconfirming:63
LEAP-Seq n unique pos:25

Suggested primers for confirmation by PCR

Suggested primer 1:GCCACGGTCAACTACCTCAT
Suggested primer 2:GTAGTGACCGGGACAAGGAA