| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.235858 |
| Chromosome: | chromosome 5 |
| Location: | 848041 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247850 | (1 of 3) 3.6.1.22//3.6.1.55 - NAD(+) diphosphatase / NADP pyrophosphatase // 8-oxo-dGTP diphosphatase / 8-oxo-dGTPase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGAACACATTCCGCTTATATTTTCTCAA |
| Internal bar code: | AGCATTCGTTCTTACTCGGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 896 |
| LEAP-Seq percent confirming: | 96.9003 |
| LEAP-Seq n confirming: | 5752 |
| LEAP-Seq n nonconfirming: | 184 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTTCCTCTTCACCCCTT |
| Suggested primer 2: | GTGAAGCGGTTGGAAGAGAG |