| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.235888 |
| Chromosome: | chromosome 6 |
| Location: | 4091696 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278219 | SSA6 | cilia-sensing, structure and/or assembly; (1 of 239) IPR016024 - Armadillo-type fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCAGTGCATTGAGATCGCAGTTAAATA |
| Internal bar code: | GTTGTCTCAATGCCCGTTGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 561 |
| LEAP-Seq percent confirming: | 98.6577 |
| LEAP-Seq n confirming: | 1764 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTGTTGTGCGAAAAATC |
| Suggested primer 2: | AGTTGGCCAAAGGACAGATG |