| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.235959 |
| Chromosome: | scaffold 50 |
| Location: | 6603 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre50.g761447 | (1 of 1) K03500 - 16S rRNA (cytosine967-C5)-methyltransferase [EC:2.1.1.176] (rsmB, sun) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATGAGCTGCTGGACGCGGCGGCGCCACT |
| Internal bar code: | ATCATTTCGCGGCAATCCCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 95.1593 |
| LEAP-Seq n confirming: | 6841 |
| LEAP-Seq n nonconfirming: | 348 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATGTTTGGAAAAGCGGTA |
| Suggested primer 2: | CTAAAGCCACCACACCACCT |