Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.236006 |
Chromosome: | chromosome 2 |
Location: | 5690960 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g110000 | (1 of 1) PF07974//PF13920 - EGF-like domain (EGF_2) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCCGATCCTGGTCTGGACCTGTTGGCC |
Internal bar code: | CCGCGCCGGTATTGGTAGGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 187 |
LEAP-Seq percent confirming: | 93.3207 |
LEAP-Seq n confirming: | 1481 |
LEAP-Seq n nonconfirming: | 106 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACATGTTGGTCAGGGCTC |
Suggested primer 2: | GTGATGTCTGCAAGCAAGGA |