Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.236040 |
Chromosome: | chromosome 14 |
Location: | 181340 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g608850 | (1 of 3) PF10075 - CSN8/PSMD8/EIF3K family (CSN8_PSD8_EIF3K) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTATCTCCACCTCGCCCTCCGCACATC |
Internal bar code: | GTAGGTCGTTTATATTGGCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 131 |
LEAP-Seq percent confirming: | 99.5772 |
LEAP-Seq n confirming: | 471 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCTCGCGAAAGTCAAGTC |
Suggested primer 2: | TTAGAGCGCAAACTGTGGTG |