Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.236056 |
Chromosome: | chromosome_13 |
Location: | 2379249 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre13.g579450 | CST1 | Chlamy-specific membrane transporter of unknown function | sense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CCGACCATTTATTTTTCACGAGCAAGATGG |
Internal bar code: | GGCTGGCATTCATCGTTGGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1273 |
LEAP-Seq percent confirming: | 99.4171 |
LEAP-Seq n confirming: | 18933 |
LEAP-Seq n nonconfirming: | 111 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTGTGAGTCCGGATGGTC |
Suggested primer 2: | AACCCACGCAATTTGAACTC |