| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.236116 |
| Chromosome: | chromosome 17 |
| Location: | 3221742 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722400 | MOT25 | Predicted protein; (1 of 1) PTHR33958//PTHR33958:SF1 - FAMILY NOT NAMED // PROTEIN C8ORF37 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTGTCCCTACGTTGACTGTGGGCTGAAC |
| Internal bar code: | TCCGGCGTTCACGGCAGTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 557 |
| LEAP-Seq percent confirming: | 98.0622 |
| LEAP-Seq n confirming: | 1923 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTTCGACCCCAAAGTGTG |
| Suggested primer 2: | CAATTTCCCAAACGAGGAGA |