| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.236137 |
| Chromosome: | chromosome 2 |
| Location: | 2308841 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g090600 | NUP43 | Nucleoporin 43; (1 of 1) PTHR22652:SF0 - NUCLEOPORIN NUP43 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCGGCATCGCGCCAGCATACTGGATTG |
| Internal bar code: | CGTCGAACCGCTAGAACCGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 136 |
| LEAP-Seq percent confirming: | 60.8856 |
| LEAP-Seq n confirming: | 165 |
| LEAP-Seq n nonconfirming: | 106 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTCATACACGTTGCTCCT |
| Suggested primer 2: | GCTGCATCTGCATCTGTGTT |