Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.236166 |
Chromosome: | chromosome 9 |
Location: | 1072627 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g400550 | NOA1 | Nitric oxide associated protein; (1 of 1) K13427 - nitric-oxide synthase, plant (NOA1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAAGCTGATGCCCCTCACATGTTCCAA |
Internal bar code: | AACTCAGATCGTTACCACCAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 796 |
LEAP-Seq percent confirming: | 99.1729 |
LEAP-Seq n confirming: | 11991 |
LEAP-Seq n nonconfirming: | 100 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTTCAGTTAAATGGGCGT |
Suggested primer 2: | GACGTGCTGAGTCAGATGGA |