| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.236199 |
| Chromosome: | chromosome 3 |
| Location: | 3311735 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166250 | FAS11,FLA6 | FAS1 domain containing protein;; (1 of 1) PF00932//PF02469 - Lamin Tail Domain (LTD) // Fasciclin domain (Fasciclin) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGGCTTTGGGCACGTGCGGTCTCGC |
| Internal bar code: | GGAGACATCTTCTCTGCTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 536 |
| LEAP-Seq percent confirming: | 98.719 |
| LEAP-Seq n confirming: | 6936 |
| LEAP-Seq n nonconfirming: | 90 |
| LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTTCACCATCGATCCCAG |
| Suggested primer 2: | AAACTCATGCGAATGACACG |