Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.236207 |
Chromosome: | chromosome 9 |
Location: | 7830865 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g416650 | Nucleotide-diphospho-sugar transferase; (1 of 6) PTHR10994//PTHR10994:SF72 - RETICULON // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGCGGGTAATTATGACTATCATGGTCG |
Internal bar code: | ATTTCTCCCGGCGCGAACGGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1039 |
LEAP-Seq percent confirming: | 84.9253 |
LEAP-Seq n confirming: | 6197 |
LEAP-Seq n nonconfirming: | 1100 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGTCGGGATTGTACTGCT |
Suggested primer 2: | TTCCTTACCCGGACAACAAG |