Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.236258 |
Chromosome: | chromosome 12 |
Location: | 2144216 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g508853 | BPL2 | Biotin-protein ligase; (1 of 41) PF13920 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGGTCTACTGGGGGGCTGCTGGGGACA |
Internal bar code: | GCTGAATTATGGTTCTGTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 470 |
LEAP-Seq percent confirming: | 99.2764 |
LEAP-Seq n confirming: | 6860 |
LEAP-Seq n nonconfirming: | 50 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATATGCGGTCCACAGGCTAC |
Suggested primer 2: | ACCGTACATCCACTGCAACA |