Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.236281 |
Chromosome: | chromosome 16 |
Location: | 5045733 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g684450 | (1 of 1) 2.7.11.1//2.7.11.25//2.7.12.2 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK // Mitogen-activated protein kinase kinase / MKK | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACACCTGGTCGCGTGTGTATGCGGTGGG |
Internal bar code: | TGTCATCGACTATGACCCGGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 883 |
LEAP-Seq percent confirming: | 99.7015 |
LEAP-Seq n confirming: | 26053 |
LEAP-Seq n nonconfirming: | 78 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGCATTAGTGCTGGTGAA |
Suggested primer 2: | GCTCAGAAGGCACCTGTTTC |