| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.236303 |
| Chromosome: | chromosome 14 |
| Location: | 1904151 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g620850 | NSG17 | (1 of 9) PF00010 - Helix-loop-helix DNA-binding domain (HLH); Basic helix-loop-helix transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAACGCCAGCTACCACCAGCAATCCTAC |
| Internal bar code: | AAGGTGGAGGCGGGACGCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 729 |
| LEAP-Seq percent confirming: | 99.5254 |
| LEAP-Seq n confirming: | 17196 |
| LEAP-Seq n nonconfirming: | 82 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGAAGTCAGGGGAAAAGG |
| Suggested primer 2: | TTGAGCAGTGGTCTGGACTG |