Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.236309 |
Chromosome: | chromosome 2 |
Location: | 4342806 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g099300 | ANK21 | (1 of 15) PF13857 - Ankyrin repeats (many copies) (Ank_5); Predicted protein with ankyrin repeats | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGTCACGCGACCTCCTCCTTCATGTCCC |
Internal bar code: | TTGTTGGTTATCTGGATTTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 956 |
LEAP-Seq percent confirming: | 87.2888 |
LEAP-Seq n confirming: | 8886 |
LEAP-Seq n nonconfirming: | 1294 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCGGTGTGATACCATCAG |
Suggested primer 2: | GGATCAAGACGGATCAAGGA |