Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.236355 |
Chromosome: | chromosome 5 |
Location: | 1750459 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g242600 | CGL106 | (1 of 2) IPR000679//IPR013088 - Zinc finger, GATA-type // Zinc finger, NHR/GATA-type; zinc finger GATA transcription factor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAGTATGACTGGACCAAGGTGGGAGTTG |
Internal bar code: | TAGCCTGCCCTTGGTTTGCGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1058 |
LEAP-Seq percent confirming: | 99.4293 |
LEAP-Seq n confirming: | 12195 |
LEAP-Seq n nonconfirming: | 70 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTGTGCTGGGTGTTTGAT |
Suggested primer 2: | CCATGGGATGGTGTGTATCA |