| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.236355 |
| Chromosome: | chromosome 5 |
| Location: | 1750475 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g242600 | CGL106 | (1 of 2) IPR000679//IPR013088 - Zinc finger, GATA-type // Zinc finger, NHR/GATA-type; zinc finger GATA transcription factor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGGCGCAAACCATACATGTGGCCTGCA |
| Internal bar code: | CGGGCTGCGTTGCCGTCCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1021 |
| LEAP-Seq percent confirming: | 96.36 |
| LEAP-Seq n confirming: | 2409 |
| LEAP-Seq n nonconfirming: | 91 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCATGGGATGGTGTGTATCA |
| Suggested primer 2: | TTGTGTGCTGGGTGTTTGAT |