| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.236367 |
| Chromosome: | chromosome 13 |
| Location: | 2341409 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g579200 | S6K1 | (1 of 1) K04688 - p70 ribosomal S6 kinase (RPS6KB); Ribosomal protein S6 kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCTCACTCGTGAACCGCGAAGCGGGAA |
| Internal bar code: | AGCGTCAAGTAGGCATATGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 477 |
| LEAP-Seq percent confirming: | 99.4647 |
| LEAP-Seq n confirming: | 7804 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGCCGTAAACAACCGTAA |
| Suggested primer 2: | GGCCATGGAAATGGTGATAC |