| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.236376 |
| Chromosome: | chromosome 16 |
| Location: | 5162465 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683450 | AGP2 | (1 of 4) 2.7.7.27 - Glucose-1-phosphate adenylyltransferase / ADP-glucose synthase; ADP-glucose pyrophosphorylase large subunit | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAACTGGGCTGGGCGAGCACTCGGGCAGT |
| Internal bar code: | GCGGCTGAGGGACATGGGAAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 98.8048 |
| LEAP-Seq n confirming: | 992 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGAACAAACACACGATGG |
| Suggested primer 2: | AGCACTTGTTTGTTGGGGAC |