| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236399 |
| Chromosome: | chromosome 1 |
| Location: | 2819256 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016750 | PSBS2 | (1 of 2) K03542 - photosystem II 22kDa protein (psbS); chloroplast Photosystem II-associated 22 kDa protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATCGCCGCCGTACTGCCCACCAGCCAG |
| Internal bar code: | AGGTGGTACCATCGGAGTGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1149 |
| LEAP-Seq percent confirming: | 90.2821 |
| LEAP-Seq n confirming: | 2016 |
| LEAP-Seq n nonconfirming: | 217 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCGACAAGCTCTCTCAC |
| Suggested primer 2: | ATTCCTGTACGGCACCAGTC |