| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236411 |
| Chromosome: | chromosome 12 |
| Location: | 5528703 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531200 | FOX2 | Multicopper ferroxidase; (1 of 2) K14735 - hephaestin (HEPH) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGTAATTTAAGTACCGTAGGCAAGAGGT |
| Internal bar code: | AATCGTCTTGTGGGGGGCCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 622 |
| LEAP-Seq percent confirming: | 99.0741 |
| LEAP-Seq n confirming: | 214 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAATGTGATGGGACTGTGG |
| Suggested primer 2: | GCCAAGTTCAGAAGGCTGTC |