Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.236411 |
Chromosome: | chromosome 13 |
Location: | 3734660 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g589350 | FBB6 | Flagellar/basal body protein 6; (1 of 1) IPR000679//IPR002035//IPR013694 - Zinc finger, GATA-type // von Willebrand factor, type A // VIT domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGTCGATTGGTTCTCGAGGCCCTCAG |
Internal bar code: | GATCCTGTTAAGAGGGAAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 574 |
LEAP-Seq percent confirming: | 97.8715 |
LEAP-Seq n confirming: | 2437 |
LEAP-Seq n nonconfirming: | 53 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGACCTTGGTCACCACCT |
Suggested primer 2: | GCAGACGGAGTTAGTGCCTC |