| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236411 |
| Chromosome: | chromosome 13 |
| Location: | 3734660 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589350 | FBB6 | Flagellar/basal body protein 6; (1 of 1) IPR000679//IPR002035//IPR013694 - Zinc finger, GATA-type // von Willebrand factor, type A // VIT domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGTCGATTGGTTCTCGAGGCCCTCAG |
| Internal bar code: | GATCCTGTTAAGAGGGAAGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 574 |
| LEAP-Seq percent confirming: | 97.8715 |
| LEAP-Seq n confirming: | 2437 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGACCTTGGTCACCACCT |
| Suggested primer 2: | GCAGACGGAGTTAGTGCCTC |