| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236448 |
| Chromosome: | chromosome 17 |
| Location: | 3219696 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722350 | RABL2A,RABL2 | RAB-Like GTP Binding Protein 2; (1 of 1) K07931 - Rab-like protein 2 (RABL2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCAATCAAGATCATCCTGCTGGGTGAC |
| Internal bar code: | TTGTTATTAAGGATTATTCTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1077 |
| LEAP-Seq percent confirming: | 98.9167 |
| LEAP-Seq n confirming: | 9770 |
| LEAP-Seq n nonconfirming: | 107 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGAGTGCATGCTGTTGAAG |
| Suggested primer 2: | AAAGTCCAACTCGCCTAGCA |