| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236465 |
| Chromosome: | chromosome 12 |
| Location: | 4592057 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g522600 | CYC1,CYC2,CYC | (1 of 1) K08738 - cytochrome c (CYC); mitochondrial cytochrome c | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGCTCACAGGCAACTTATTATGTCTGCC |
| Internal bar code: | CGCCAATCTGGTAGCCTTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 744 |
| LEAP-Seq percent confirming: | 98.2198 |
| LEAP-Seq n confirming: | 1269 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGTGGGCTGTTACCAAA |
| Suggested primer 2: | TTTCAAAAGCTGCGTGAATG |