| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236474 |
| Chromosome: | chromosome 6 |
| Location: | 5544973 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285200 | NDH1 | Nucleoside diphosphate hydrolase; (1 of 1) 3.6.1.13//3.6.1.18 - ADP-ribose diphosphatase / ADPR-PPase // FAD diphosphatase / FAD pyrophosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAATGTGTTGAAAAGCACAAGGAAAAAA |
| Internal bar code: | GGTTCCCGCGGCCGCGACACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAAAGGACGCTTGTACTC |
| Suggested primer 2: | AATAGCGGAGGTGACGCTAA |