| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236477 |
| Chromosome: | chromosome 2 |
| Location: | 7249149 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145700 | AOT1 | Amino acid transporter; (1 of 2) K14207 - solute carrier family 38 (sodium-coupled neutral amino acid transporter), member 2 (SLC38A2, SNAT2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTCGTATCACGACAGGGCCAAGGGTGA |
| Internal bar code: | GCCCCCGGTAGAGGTGACCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 564 |
| LEAP-Seq percent confirming: | 99.2701 |
| LEAP-Seq n confirming: | 272 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCGATACACACGAAAAGGT |
| Suggested primer 2: | CCACAAACATTCACAGGTGC |