Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.236538 |
Chromosome: | chromosome 10 |
Location: | 3357262 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g443900 | BOR1 | (1 of 1) PF00955 - HCO3- transporter family (HCO3_cotransp); Borate transporter | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATGCGTCCTGATCTGTGAAAGGGATCGG |
Internal bar code: | TTGACCGTATACCTGTGGCACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1098 |
LEAP-Seq percent confirming: | 99.2713 |
LEAP-Seq n confirming: | 9536 |
LEAP-Seq n nonconfirming: | 70 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGCTCCGGTGCTATCTAC |
Suggested primer 2: | CATCACCACACATCACCACA |