| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236552 |
| Chromosome: | chromosome 5 |
| Location: | 779685 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g248300 | NRAMP4 | Manganese/metal transporter, NRAMP homolog; (1 of 1) K12347 - natural resistance-associated macrophage protein (SLC11A, NRAMP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAAAACACGTCCAATGGACGAAGCGCAA |
| Internal bar code: | GTACTTGCAGTCAATTGCAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 414 |
| LEAP-Seq percent confirming: | 75.7525 |
| LEAP-Seq n confirming: | 906 |
| LEAP-Seq n nonconfirming: | 290 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTACAACCGTGCCCTAAAA |
| Suggested primer 2: | TTCTCAACCCACCTACCTGC |