| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236566 |
| Chromosome: | chromosome 2 |
| Location: | 4399333 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099650 | (1 of 1) PF03661 - Uncharacterised protein family (UPF0121) (UPF0121) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACGCTGCCGCGCACCCAGCAGCACCTTT |
| Internal bar code: | GCGAGTGGACCCGGTTTGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 755 |
| LEAP-Seq percent confirming: | 99.5733 |
| LEAP-Seq n confirming: | 4200 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCACCTGACGAGAACTTG |
| Suggested primer 2: | CATAACAGCGCAAACAGCAT |