| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236575 |
| Chromosome: | chromosome 7 |
| Location: | 91179 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g312750 | CSL4 | (1 of 1) K07573 - exosome complex component CSL4 (CSL4, EXOSC1); Exosome component, Csl4 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGACAACGCCCAACTCGTTCTTGGCTGT |
| Internal bar code: | CCGGGTGGTGTCATGGTGCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 701 |
| LEAP-Seq percent confirming: | 98.9031 |
| LEAP-Seq n confirming: | 541 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACTGTCAAGCGTCTGAA |
| Suggested primer 2: | AAGATGACTCCATTGTCGGG |