| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.236693 |
| Chromosome: | chromosome 16 |
| Location: | 7753681 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692004 | DNJ21 | (1 of 8) PF00226//PF01556 - DnaJ domain (DnaJ) // DnaJ C terminal domain (DnaJ_C); DnaJ-like protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTCACACTGCTGGCACTGCCGCAGCG |
| Internal bar code: | TCATAATTTTTCTGAGCAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 99.4183 |
| LEAP-Seq n confirming: | 3589 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACGAAGGGAGCATGTGGT |
| Suggested primer 2: | CACAAGTATCACCACGGACG |