| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.236830 |
| Chromosome: | chromosome 1 |
| Location: | 6106477 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g043550 | (1 of 3) IPR000104//IPR004333 - Antifreeze protein, type I // Transcription factor, SBP-box | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATAAATAACTGATGGTTGCGCGTTCCCA |
| Internal bar code: | AATGTTGTTATGGTTTCGAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 830 |
| LEAP-Seq percent confirming: | 99.3652 |
| LEAP-Seq n confirming: | 8766 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGAACGGTATGTGACCT |
| Suggested primer 2: | TGCAAGGGCGTATAATAGGG |