| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.236834 |
| Chromosome: | chromosome 10 |
| Location: | 4797094 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453807 | CTPB1 | (1 of 2) PTHR32060:SF5 - PEPTIDASE S41 FAMILY PROTEIN; C-terminal peptidase B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTTCAAACTTCAAGCGCCTTGACCATA |
| Internal bar code: | GATGTCGTACAATGTGAGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 680 |
| LEAP-Seq percent confirming: | 98.75 |
| LEAP-Seq n confirming: | 474 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGGAGGGACTAAGCAAAT |
| Suggested primer 2: | ATGCATGGAGAGCGAGAGTT |