Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.236861 |
Chromosome: | chromosome 2 |
Location: | 4237136 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g098750 | (1 of 7) PF00027//PF00520 - Cyclic nucleotide-binding domain (cNMP_binding) // Ion transport protein (Ion_trans) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGGCCGGGCCGCGGGCACTCCGCCCCAC |
Internal bar code: | TGTTCGCAACGCGTCAGCACGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 423 |
LEAP-Seq percent confirming: | 97.6744 |
LEAP-Seq n confirming: | 126 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTTGCGTTTCCACTGCTT |
Suggested primer 2: | ACACACACACACACACACCG |