| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.236895 |
| Chromosome: | chromosome 3 |
| Location: | 9093730 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g211073 | (1 of 2) K14497 - protein phosphatase 2C (PP2C) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATAGCACTACTACTTTTGGGCACTATC |
| Internal bar code: | GAAGACGGCCGCGCCTGCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 799 |
| LEAP-Seq percent confirming: | 99.0499 |
| LEAP-Seq n confirming: | 5317 |
| LEAP-Seq n nonconfirming: | 51 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTGTCGACTGCTTGTCACC |
| Suggested primer 2: | CCCTGCGGTATACACGTTCT |