| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236936 |
| Chromosome: | chromosome 7 |
| Location: | 1787894 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325722 | (1 of 1) PTHR13215:SF0 - SUB1 HOMOLOG (S. CEREVISIAE); RNA polymerase coactivator | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGTGGATTTACGCATGGGCGCTCCAGACA |
| Internal bar code: | GGGGGACTCCAAGTGGAGAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2325 |
| LEAP-Seq percent confirming: | 98.6211 |
| LEAP-Seq n confirming: | 1502 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAAACCTCCCATACACAC |
| Suggested primer 2: | GACTAAATACAGCGCCTCGC |