| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.236937 |
| Chromosome: | chromosome 8 |
| Location: | 3558147 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g375550 | (1 of 25) IPR013216//IPR029063 - Methyltransferase type 11 // S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAACTTTGTCAAAACCGCGCAGGCTGCC |
| Internal bar code: | GATAGCCAAACGGACGGGCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 590 |
| LEAP-Seq percent confirming: | 98.7094 |
| LEAP-Seq n confirming: | 2830 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAAAGGGGTAAAACGTC |
| Suggested primer 2: | ACAGGGTGGGATGTTGAAAG |