| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.236944 |
| Chromosome: | chromosome 13 |
| Location: | 4929774 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g606101 | (1 of 2) PTHR19959//PTHR19959:SF147 - KINESIN LIGHT CHAIN // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCTTGACTCACCCGATCAGGTTGGGCC |
| Internal bar code: | GCAAGAGGCCGTCATCCACGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 704 |
| LEAP-Seq percent confirming: | 60.2626 |
| LEAP-Seq n confirming: | 14733 |
| LEAP-Seq n nonconfirming: | 9715 |
| LEAP-Seq n unique pos: | 157 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCAACCAAGCCAAACAAG |
| Suggested primer 2: | AGCCACAGTACCACCAGTCC |