Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.237057 |
Chromosome: | chromosome 12 |
Location: | 1010420 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g491500 | UBA2,UBA3,UBC1 | RUB1/NEDD8 E1 activating enzyme; (1 of 1) K10686 - ubiquitin-activating enzyme E1 C (UBE1C, UBA3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAAAGCCGCCCTGCAACTCTCCCTGCGCT |
Internal bar code: | CTTTGCCAGCCGCCCGGATTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 142 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGACAGGCAAGGAGGAGA |
Suggested primer 2: | GTAACCCCACCACCCTACCT |