Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.237084 |
Chromosome: | chromosome 1 |
Location: | 2553792 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g014800 | MSH7,CPL21 | putative MutS type 2 DNA repair protein; (1 of 1) K07456 - DNA mismatch repair protein MutS2 (mutS2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCGCCACTCCCAGCTCCCATGCAAGTCG |
Internal bar code: | CAGCCGGCTCGCCGATGTGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1080 |
LEAP-Seq percent confirming: | 99.6709 |
LEAP-Seq n confirming: | 1817 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTCAATTCAAAACCGCCT |
Suggested primer 2: | GTCTATTCTTGCCCTGCGAC |