| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237100 |
| Chromosome: | chromosome 9 |
| Location: | 2065768 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394100 | AP1S1 | (1 of 1) K12394 - AP-1 complex subunit sigma 1/2 (AP1S1_2); Sigma1-Adaptin | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAGTCGACCCGGCTTCGCGGGGTATGGC |
| Internal bar code: | CTTACTGGGCCGTTGCTGCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 573 |
| LEAP-Seq percent confirming: | 98.3832 |
| LEAP-Seq n confirming: | 6998 |
| LEAP-Seq n nonconfirming: | 115 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTAAGCTTCAACTCGCACCC |
| Suggested primer 2: | CTGCTTACAGCCCCAGACTC |