| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.237174 |
| Chromosome: | chromosome 3 |
| Location: | 1245865 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g149900 | (1 of 1) IPR027369 - DinB/YfiT-like putative metal-dependent hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGCATGCCCCCGAGCCCGCGACCATCT |
| Internal bar code: | AGTCTTGGCTTGGTCACTGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 715 |
| LEAP-Seq percent confirming: | 98.497 |
| LEAP-Seq n confirming: | 7012 |
| LEAP-Seq n nonconfirming: | 107 |
| LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGGCCTTCATGTACTGGT |
| Suggested primer 2: | GCCGATGTTCATCAGGAAGT |